Skip to content

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

2 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Optimized DNA/RNA Storage

Sequence Encoder and Decoder

This project provides tools to:

  • Convert multi-sequence FASTA files into individual compressed .seq binary files.
  • Encode DNA/RNA sequences using 2-bit representations.
  • Preserve metadata, type (DNA/RNA), and support versioning.
  • Reconstruct .fasta files from .seq binaries.

Format Specification

.seq File Structure

Offset  Size      Description
0       4         Signature: "SEQ\x01"
4       1         Version (currently 0x01)
5       4         Metadata length (uint32_t)
9       N         Metadata string (FASTA header)
9+N     1         Type: 1 = DNA, 2 = RNA
10+N    8         Sequence length in bases (uint64_t)
18+N    ?         Sequence data (2 bits per base, packed)

Bases are encoded as follows:

Base Bits Decimal
A 00 0
C 01 1
G 10 2
T/U 11 3

Encoding Notes

  • RNA sequences are detected if they contain U and converted to type 2.
  • The encoder replaces U with T internally for 2-bit packing.
  • Metadata is the entire FASTA header line (starting with >).

Usage

This program supports two modes based on the number of arguments:

# Converts FASTA to .seq files
./program <input.fasta> 
# Converts a .seq file back to FASTA
./program <input.seq> <output.fasta>  
  • If only one argument is given, it treats it as a FASTA file and parses it into .seq files.
  • If two arguments are given, it decodes the .seq file into a valid FASTA file.

Example FASTA File

>example_sequence_53
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTA

Compression Efficiency at Scale

The following demonstrates projected compression results when scaling to a large dataset:

  • Original FASTA file size: 39.9 GB
  • After .seq encoding: 9.8 GB
  • After 7zip compression: 8.2 GB

This shows that with 2-bit encoding and efficient archiving:

  • The encoded file is ~75% smaller than the original FASTA.
  • The archived .dna file further reduces storage requirements.
  • Metadata remains accessible without decompressing the entire archive.

This scale makes the format practical for handling large genomic datasets such as entire chromosomes or transcriptome libraries.

Future Features

  • Combine multiple .seq files into a single .dna archive/
  • Add .dna archive reader/unpacker.
  • Optional compression for .dna archives with metadata.
  • GUI Tools.

Note: 7zip is a good fit for its robust archiving capabilities, especially its support for bundling both binary .seq files and accompanying metadata (e.g., JSON) to a .dna archive. This allows for efficient storage and distribution, while also enabling users,gui, or tools to quickly extract metadata files without unpacking the entire (potentially large) archive.


Handling Biological Data Quirks

FASTA files from real-world sources often contain edge cases that must be handled with care. Our format currently uses a compact 2-bit encoding scheme for DNA/RNA sequences, which assumes only four standard bases: A, C, G, and T/U.

However, actual sequence data frequently includes the following quirks:

1. N Bases (Unknown/Any)

  • N is a standard IUPAC nucleotide representing any base (A/C/G/T).
  • Common in genome gaps, unresolved regions, and low-quality reads.
  • Solution: We store the positions of N bases in the metadata to preserve full sequence information.

2. Other IUPAC Ambiguity Codes

  • Codes like R, Y, S, W, etc., represent multiple possible bases.
  • These are less common but appear in some variant-rich datasets.
  • Current Handling: These bases are not yet supported and will cause the encoder to skip or abort. A warning is logged.
  • Future Plan: Consider expanding support or filtering them pre-encoding.

3. Mixed or Lowercase Bases: Done ✅

  • Some FASTA files use lowercase letters to represent soft-masked regions (e.g., repeats).
  • Current Handling: All bases are normalized to uppercase.

4. Sequence Wrapping and Line Endings: Done ✅

  • Lines may be wrapped at different lengths (60, 80, or unwrapped).
  • Files may include Windows (\r\n) or UNIX (\n) line endings.
  • Current Handling: The parser reads sequences continuously, ignoring line breaks.

5. Multiple Sequences per FASTA

  • Many FASTA files contain multiple records.
  • Handling: Each sequence is extracted and encoded into a separate .seq file with metadata and type information.

Note: Our .seq encoder is intentionally strict to ensure reliable 2-bit packing. However, these quirks must be resolved (filtered, tracked, or logged) to avoid losing information or causing encoding failures.

Build

Compile with a C compiler:

make

License

Apache 2.0 License

About

A compact binary format and toolset for encoding, storing, and efficiently archiving DNA/RNA sequences from FASTA files using 2-bit compression and embedded metadata.

Topics

Resources

Stars

0 stars

Watchers

0 watching

Forks

Releases

Packages

Contributors

Languages