Replies: 4 comments 6 replies
|
This should be rendered obsolete if we solve #1207 in the underlying C code. |
|
I used the haplotypes2 function, and it is a more concise version of the one I had running, but I'm having the same problem when trying to print the haplotypes without the
and no haplotypes are generated. |
|
I'm trying to understand if the context of these functions fits my problem. I need to generate the sequence of an immediate ancestral node to a sampled node. I can I use either of these functions to build this kind of sequence? (so far haplotypes2 is not doing working for this, but I don't quite follow how it works). |
|
Thanks very much. I'm only getting parts of the logic at the moment, so I can't confirm that it does what is intended. The number of sits is correct, and the base values look quite plausible.
e.g. in a case where 0 is focal and there are 6 samples and the topology is ((((0,(1,2)),3),4),5) (the root is on the edge to 5)
0parent GCTTTTTGGGATGTCGTCGTGAGGCGGGGGCGCCTTTACGGTCATTGTCCTCTACTGTACACAAAGTAGTGTAGTTGACT
0 GCTTTTTGGGATGTCGTCGTGCGGCGGGGGCGCCTTGACGGTCATTGTCCTCTACTGTACAAAAAGTAGTGTAGGCGTCT
1 GCTTTTTGGGAGGTCGTCGTGGGGCGGGGGCGCCCTTACGGTTATTGTCCTCTACTGTGCACAAAGTAGTGGAATTGACT
2 GCTTTTTGGGAGGTCGTCGTGGGGCGGGGGCGCCCTTACGGTTATTGTCCTGTACTGAGCACAGAGTAGTGGAATTGACT
3 GATTTGTAGGACGTCGGCGCGAAGTGGGGGCGCCTTTACGGTCATCGTCCACTACTGTGCACAAAGGGGTGTAGTTGACT
4 GCCTATCGGGCGGTGATGATTAGACGAGGTCGGACGTGGAAGCCTTGTGGTCTGAGGTGCCCCACGTAGTGTAGTTGACT
5 ACCCCTTGTTCTCCCATCGTGAGGCCGACTTTGCTTGGCAACACCAACCCTCCACAATATCCATCGTACACTCGTTTAAA
On Tuesday, March 29, 2022, 09:45:10 AM EDT, Yan Wong ***@***.***> wrote:
Useful for thinking about some ancestor estimation issues.
Yes, I can see that it gives rise to interesting trains of thought. Does the code I posted make sense (and does it work for you?!)
—
Reply to this email directly, view it on GitHub, or unsubscribe.
You are receiving this because you were mentioned.Message ID: ***@***.***>
|
Uh oh!
There was an error while loading. Please reload this page.
Uh oh!
There was an error while loading. Please reload this page.
Several people (e.g. @saurabhbelsare ) have wanted to be able to extract ancestral genotypes or haplotypes for nodes in a tree sequence. At the moment there's no built-in way to do this in tskit. The simplest way is to flag all the required nodes as samples, and use the methods directly there. For instance:
or
All reactions